Lakhasly

Online English Summarizer tool, free and accurate!

Summarize result (50%)

S16 rRNA gene based identication

The isolates were identified by sequencing of the 16S rRNA gene.Homology search was performed using Bioinformatics tools available online BLASTn www.ncbi.nlm.nih.gov/BLA (Altschul et al., 1997).


Original text

S16 rRNA gene based identication


The isolates were identified by sequencing of the 16S rRNA gene. To determine the identification of bacterial isolates, the amplified 16S rRNA gene PCR products obtained from total genomic DNA using primer set 27F (52 AGAGTTTGATCCTGGCTCAG 32) and R (52 GGTTACCTTGTTACGACTT-32),


(Lane et al., 1985) were sequenced commercially. DNA sequences obtained were compared to sequences available online in a Gen Bank database (http://www.ncbi.nlm.nih.gov). Homology search was performed using Bioinformatics tools available online BLASTn www.ncbi.nlm.nih.gov/BLA (Altschul et al., 1997).


Summarize English and Arabic text online

Summarize text automatically

Summarize English and Arabic text using the statistical algorithm and sorting sentences based on its importance

Download Summary

You can download the summary result with one of any available formats such as PDF,DOCX and TXT

Permanent URL

ٌYou can share the summary link easily, we keep the summary on the website for future reference,except for private summaries.

Other Features

We are working on adding new features to make summarization more easy and accurate


Latest summaries

Summarize to th...

Summarize to the lawyer, اود ان الفت نظرك لنقطة خطيرة جدا و هي سبب لمخاوفي و قلقي و هي ان من السه...

أفادت منصة "شيب...

أفادت منصة "شيبا إنتلجنس" المتخصصة في الشؤون الاستخباراتية، أن ميليشا الحوثي قامت بنقل شحنة صواريخ إ...

الاحتيال عبر رم...

الاحتيال عبر رموز الاستجابة السريعة QR Code Fraud أو Quishing)  ) . مصطلح مُركّب من كلمتي QR code وP...

لعل التقويم الت...

لعل التقويم التربوي يعد وضروريا للإدارة والقيادات التربوية، فهو عملية مقصودة مهما ومطلوبة يقوم من خل...

تاريخ وفلسفة ال...

تاريخ وفلسفة المالية مدخل نظري في تطور الفكر المالي ووظائف المالية العمومية مقدمة لا يمكن فهم قانون ...

استوطن البشرُ ا...

استوطن البشرُ المغربَ منذ العصر الحجري القديم، أيْ من قبل 500-700 ألف سنة، وقد بدأ اهتمام البشر بالز...

فرمان الامتياز ...

فرمان الامتياز الأول ([3]) : صدر فرمان الامتياز الأول الذى منح فرديناند ديلسبس حق إنشاء شركة لشق قن...

لهذه المنظومة. ...

لهذه المنظومة. ويغدو من الضروري أولاً تبيان ماهية التراث الثقافي من المنظور التشريعي الوطني، وذلك من...

*Hou Shuren is ...

*Hou Shuren is the emperor's heir. He is just and respectable. Rumors say that he does not trust eas...

أنه انفصل عن عص...

أنه انفصل عن عصره، فقد مضى يزاوج بين الماضي والحاضر، يتلقى الماضي وبحباه، ويتلقى الحاضر ويحياه. الم...

تم حساب المتوسط...

تم حساب المتوسط الحسابي والانحراف المعياري للدرجة الكلية للبُعد الأول من أداة الدراسة، والمتعلق بتفع...

الأسس التي تقوم...

الأسس التي تقوم عليها الطريقة: جاءت الطرائق المثلى نتيجة اختبار طويل وتجريب علمي وملاحظات كثيرة وتأم...