Online English Summarizer tool, free and accurate!
S16 rRNA gene based identication
The isolates were identified by sequencing of the 16S rRNA gene.Homology search was performed using Bioinformatics tools available online BLASTn www.ncbi.nlm.nih.gov/BLA (Altschul et al., 1997).
S16 rRNA gene based identication
The isolates were identified by sequencing of the 16S rRNA gene. To determine the identification of bacterial isolates, the amplified 16S rRNA gene PCR products obtained from total genomic DNA using primer set 27F (52 AGAGTTTGATCCTGGCTCAG 32) and R (52 GGTTACCTTGTTACGACTT-32),
(Lane et al., 1985) were sequenced commercially. DNA sequences obtained were compared to sequences available online in a Gen Bank database (http://www.ncbi.nlm.nih.gov). Homology search was performed using Bioinformatics tools available online BLASTn www.ncbi.nlm.nih.gov/BLA (Altschul et al., 1997).
Summarize English and Arabic text using the statistical algorithm and sorting sentences based on its importance
You can download the summary result with one of any available formats such as PDF,DOCX and TXT
ٌYou can share the summary link easily, we keep the summary on the website for future reference,except for private summaries.
We are working on adding new features to make summarization more easy and accurate
أكد تقرير المعهد الشرق الأوسط أن الهدنة المعلنة في 6 مايو بين الولايات المتحدة والحوثيين، المدعومين ...
The only comment is that the time of the doctor's availability is up to 430, 5 o'clock only However...
The only comment is that the time of the doctor's availability is up to 430, 5 o'clock only However...
They are serving a very dry steamed chicken breast and not tasty and the fish the should provide th...
A loop of wire that forms a circuit crosses a magnetic field. When the wire is stationary or moved p...
تعد مهارة التواصل من المهارات المهمة التي يعتمد عليها الإنسان، سواء على الصعيد المهني او الشخصي. كما...
The doctor is very brilliant . She told us how to control the sugar , gave advices to my son and tol...
تعتبر وفيات الأطفال واعتلال صحتهم من القضايا الصحية العاجلة التي تتطلب فهمًا عميقًا للعوامل المتعددة...
القطاع الزراعي يعتبر القطاع الزراعي بشقيه الحيواني و النباتي من أهم القطاعات في السودان حيث يضم 80...
يبدو أن نهاية حقبة نتنياهو قد اقتربت فعلا هذه المرة. إدارة ترامب تعتقد أن الضربات الأخيرة على إيران ...
تؤثر الألعاب الإلكترونية بشكل سلبي على المراهقين، خاصة في حال استخدامها بشكل مفرط أو عند اختيار ألعا...
إقليم تيغراي الإثيوبي. هذه التوترات تأتي على خلفية تباين أهداف الدولتين خلال الحرب في تيغراي، حيث سع...